biotechnologia


 
 

Przewidywanie drugorzędowej struktury RNA

Vienna RNA server, dostępny pod adresem http://rna.tbi.univie.ac.at/ zawiera pakiet darmowych opartych na sieci programów, które przewidują struktury drugorzędowe RNA, używając pakiet oprogramowania Vienna RNA. RNAfold serwera Vienna RNA jest najprostszym serwerem pomocniczym predykcji struktury.

Prosta metoda przewidywania struktury drugorzędowej RNA polega na ustalaniu minimalnej darmowej energii struktury (mfe) przy użyciu algorytmu Zucker’a i Stiegler’a oraz podstawy równowagi prawdopodobieństwa parowania przy użyciu algorytmu John’a McCaskill’a dla pojedynczej sekwencji RNA. Funkcja ta znajduje się w RNAfold serwera, który jest częścią pakietu Vienna RNA serwer (dostępna pod adresem http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi).

RNAfold serwer w pakiecie Vienna RNA server zostało użyte do kalkulacji predykcji drugorzędowej struktury dwóch sekwencji RNA, ryboprzełącznik lizyny Thermotoga maritima oraz odwrotnej transkryptazyludzkiej telomerazy (TERT) zapis wariantu 1 mRNA. Pierwotną sekwencję RNA dla ryboprzełącznika lizyny Thermotoga maritima uzyskano ze strony www RCSB białkowego banku danych( http://www.rcsb.org/pdb/explore/explore.do?structureId=3DIL),oraz sekwencja dla TERT została uzyskanaze strony www NCBI ( http://www.ncbi.nlm.nih.gov/nuccore/NM_198253.2).

Sekwencja TM-Lys:
>3DIL:A|PDBID|CHAIN|SEQUENCE
GGCCGACGGAGGCGCGCCCGAGAUGAGUAGGCUGUCCCAUCAGGGGAGGAAUCGGGGACGGCUGA
AAGGCGAGGGCGCCGAAGGGUGCAGAGUUCCUCCCGCUCUGCAUGCCUGGGGGUAUGGGGA
AUACCCAUACCACUGUCACGGAGGUCUCUCCGUGGAGAGCCGUCGGUC

Sekwencja TERT:
>gi|109633030|ref|NM_198253.2| Homo sapiens telomerase reverse transcriptase (TERT), transcript variant 1, mRNA
CAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAAGCCCTGGCCCCGGCCACCCCCGCGATGCCGCGCG
CTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCACTACCGCGAGGTGCTGCCGCTGGCCA
CGTTCGTGCGGCGCCTGGGGCCCCAGGGCTGGCGGCTGGTGCAGCGCGGGGACCCGGCGGCTTT
CCGCGCGCTGGTGGCCCAGTGCCTGGTGTGCGTGCCCTGGGACGCACGGCCGCCCCCCGCCGCCC
CCTCCTTCCGCCAGGTGTCCTGCCTGAAGGAGCTGGTGGCCCGAGTGCTGCAGAGGCTGTGCGAG
CGCGGCGCGAAGAACGTGCTGGCCTTCGGCTTCGCGCTGCTGGACGGGGCCCGCGGGGGCCCCC
CCGAGGCCTTCACCACCAGCGTGCGCAGCTACCTGCCCAACACGGTGACCGACGCACTGCGGGGGA
GCGGGGCGTGGGGGCTGCTGCTGCGCCGCGTGGGCGACGACGTGCTGGTTCACCTGCTGGCACG
CTGCGCGCTCTTTGTGCTGGTGGCTCCCAGCTGCGCCTACCAGGTGTGCGGGCCGCCGCTGTACCA
GCTCGGCGCTGCCACTCAGGCCCGGCCCCCGCCACACGCTAGTGGACCCCGAAGGCGTCTGGGAT
GCGAACGGGCCTGGAACCATAGCGTCAGGGAGGCCGGGGTCCCCCTGGGCCTGCCAGCCCCGGG
TGCGAGGAGGCGCGGGGGCAGTGCCAGCCGAAGTCTGCCGTTGCCCAAGAGGCCCAGGCGTGGC
GCTGCCCCTGAGCCGGAGCGGACGCCCGTTGGGCAGGGGTCCTGGGCCCACCCGGGCAGGACGC
GTGGACCGAGTGACCGTGGTTTCTGTGTGGTGTCACCTGCCAGACCCGCCGAAGAAGCCACCTCTT
TGGAGGGTGCGCTCTCTGGCACGCGCCACTCCCACCCATCCGTGGGCCGCCAGCACCACGCGGGC
CCCCCATCCACATCGCGGCCACCACGTCCCTGGGACACGCCTTGTCCCCCGGTGTACGCCGAGACC
AAGCACTTCCTCTACTCCTCAGGCGACAAGGAGCAGCTGCGGCCCTCCTTCCTACTCAGCTCTCTGA
GGCCCAGCCTGACTGGCGCTCGGAGGCTCGTGGAGACCATCTTTCTGGGTTCCAGGCCCTGGATG
CCAGGGACTCCCCGCAGGTTGCCCCGCCTGCCCCAGCGCTACTGGCAAATGCGGCCCCTGTTTCTGG
AGCTGCTTGGGAACCACGCGCAGTGCCCCTACGGGGTGCTCCTCAAGACGCACTGCCCGCTGCGA
GCTGCGGTCACCCCAGCAGCCGGTGTCTGTGCCCGGGAGAAGCCCCAGGGCTCTGTGGCGGCCCC
CGAGGAGGAGGACACAGACCCCCGTCGCCTGGTGCAGCTGCTCCGCCAGCACAGCAGCCCCTGGC
AGGTGTACGGCTTCGTGCGGGCCTGCCTGCGCCGGCTGGTGCCCCCAGGCCTCTGGGGCTCCAGG
CACAACGAACGCCGCTTCCTCAGGAACACCAAGAAGTTCATCTCCCTGGGGAAGCATGCCAAGCTC
TCGCTGCAGGAGCTGACGTGGAAGATGAGCGTGCGGGACTGCGCTTGGCTGCGCAGGAGCCCAG
GGGTTGGCTGTGTTCCGGCCGCAGAGCACCGTCTGCGTGAGGAGATCCTGGCCAAGTTCCTGCAC
TGGCTGATGAGTGTGTACGTCGTCGAGCTGCTCAGGTCTTTCTTTTATGTCACGGAGACCACGTTTC
AAAAGAACAGGCTCTTTTTCTACCGGAAGAGTGTCTGGAGCAAGTTGCAAAGCATTG
GAATCAGACAGCACTTGAAGAGGGTGCAGCTGCGGGAGCTGTCGGAAGCAGAGGTCAGGCAGCA
TCGGGAAGCCAGGCCCGCCCTGCTGACGTCCAGACTCCGCTTCATCCCCAAGCCTGACGGGCTGCG
GCCGATTGTGAACATGGACTACGTCGTGGGAGCCAGAACGTTCCGCAGAGAAAAGAGGGCCGAG
CGTCTCACCTCGAGGGTGAAGGCACTGTTCAGCGTGCTCAACTACGAGCGGGCGCGGCGCCCCGG
CCTCCTGGGCGCCTCTGTGCTGGGCCTGGACGATATCCACAGGGCCTGGCGCACCTTCGTGCTGCG
TGTGCGGGCCCAGGACCCGCCGCCTGAGCTGTACTTTGTCAAGGTGGATGTGACGGGCGCGTACG
ACACCATCCCCCAGGACAGGCTCACGGAGGTCATCGCCAGCATCATCAAACCCCAGAACACGTACT
GCGTGCGTCGGTATGCCGTGGTCCAGAAGGCCGCCCATGGGCACGTCCGCAAGGCCTTCAAGAGC
CACGTCTCTACCTTGACAGACCTCCAGCCGTACATGCGACAGTTCGTGGCTCACCTGCAGGAGACC
AGCCCGCTGAGGGATGCCGTCGTCATCGAGCAGAGCTCCTCCCTGAATGAGGCCAGCAGTGGCCT
CTTCGACGTCTTCCTACGCTTCATGTGCCACCACGCCGTGCGCATCAGGGGCAAGTCCTACGTCCAG
TGCCAGGGGATCCCGCAGGGCTCCATCCTCTCCACGCTGCTCTGCAGCCTGTGCTACGGCGACATG
GAGAACAAGCTGTTTGCGGGGATTCGGCGGGACGGGCTGCTCCTGCGTTTGGTGGATGATTTCTT
GTTGGTGACACCTCACCTCACCCACGCGAAAACCTTCCTCAGGACCCTGGTCCGAGGTGTCCCTGA
GTATGGCTGCGTGGTGAACTTGCGGAAGACAGTGGTGAACTTCCCTGTAGAAGACGAGGCCCTGG
GTGGCACGGCTTTTGTTCAGATGCCGGCCCACGGCCTATTCCCCTGGTGCGGCCTGCTGCTGGATA
CCCGGACCCTGGAGGTGCAGAGCGACTACTCCAGCTATGCCCGGACCTCCATCAGAGCCAGTCTCA
CCTTCAACCGCGGCTTCAAGGCTGGGAGGAACATGCGTCGCAAACTCTTTGGGGTCTTGCGGCTGA
AGTGTCACAGCCTGTTTCTGGATTTGCAGGTGAACAGCCTCCAGACGGTGTGCACCAACATCTACA
AGATCCTCCTGCTGCAGGCGTACAGGTTTCACGCATGTGTGCTGCAGCTCCCATTTCATCAGCAAGT
TTGGAAGAACCCCACATTTTTCCTGCGCGTCATCTCTGACACGGCCTCCCTCTGCTACTCCATCCTGA
AAGCCAAGAACGCAGGGATGTCGCTGGGGGCCAAGGGCGCCGCCGGCCCTCTGCCCTCCGAGGC
CGTGCAGTGGCTGTGCCACCAAGCATTCCTGCTCAAGCTGACTCGACACCGTGTCACCTACGTGCC
ACTCCTGGGGTCACTCAGGACAGCCCAGACGCAGCTGAGTCGGAAGCTCCCGGGGACGACGCTGA
CTGCCCTGGAGGCCGCAGCCAACCCGGCACTGCCCTCAGACTTCAAGACCATCCTGGACTGATGGC
CACCCGCCCACAGCCAGGCCGAGAGCAGACACCAGCAGCCCTGTCACGCCGGGCTCTACGTCCCA
GGGAGGGAGGGGCGGCCCACACCCAGGCCCGCACCGCTGGGAGTCTGAGGCCTGAGTGAGTGTTT
GGCCGAGGCCTGCATGTCCGGCTGAAGGCTGAGTGTCCGGCTGAGGCCTGAGCGAGTGTCCAGCC
AAGGGCTGAGTGTCCAGCACACCTGCCGTCTTCACTTCCCCACAGGCTGGCGCTCGGCTCCACCCC
AGGGCCAGCTTTTCCTCACCAGGAGCCCGGCTTCCACTCCCCACATAGGAATAGTCCATCCCCAGAT
TCGCCATTGTTCACCCCTCGCCCTGCCCTCCTTTGCCTTCCACCCCCACCATCCAGGTGGAGACCCTG
AGAAGGACCCTGGGAGCTCTGGGAATTTGGAGTGACCAAAGGTGTGCCCTGTACACAGGCGAGG
ACCCTGCACCTGGATGGGGGTCCCTGTGGGTCAAATTGGGGGGAGGTGCTGTGGGAGTAAAATA
CTGAATATATGAGTTTTTCAGTTTTGAAAAAAA


Obie sekwencje zostały indywidualnie wpisane w oknie dialogowym RNAfold serwera Vienna Web Server.



Wyniki:

Sekwencje TM_Lys i TERT zostały indywidualnie wpisane do okna dialogowego RNAfold WebServer do przewidywania drugorzędowej struktury przy użyciu minimalnej swobodnej energii oraz algorytmu funkcji partycji.





Na sekwencję nie narzucono żadnych strukturalnych ograniczeń, MFE i funkcje partycji zostały wybrane, a zaawansowane opcje pozostawione przy wartościach domyślnych.






Wybrane opcje wyjściowe to:
- interactive RNA secondary structure plot
- RNA secondary structure plots with reliability annotation (partition function folding only)
- mountain plot (pętle reprezentowane przez płaskowyże, serpentyny przez szczyty, a helisy przez stoki). Guzik Proceed rozpoczyna analyze, a następna strona zawiera adres URL dostępowy do rezultatu wykonanych obliczeń, dostarcza kolejkowanie zadań i pokazuje różne etapy w obliczaniu.




Poniższa strona wynikowa ukazuje predykcję drugorzędowej struktury, zapewniając możliwość pseudo kolorowania podstawowej sekwencji i predykcji kodu na podstawie minimum jednej darmowej energii, podstawy parowania prawdopodobieństwa lub algorytmów pozycyjnej entropiiw następujący sposób:




Dla TM_Lys wynik przewidywania minimalnej darmowej energii w notacji dot-bracket (pary zasad są oznaczone przez '(---)', zasady bez pary są oznaczone przez '.') bez parowania zasad lub pozycyjnej entropii jest następujący:

1
GGCCGACGGAGGCGCGCCCGAGAUGAGUAGGCUGUCCCAUCAGGGGAGGAAUCGGGGACGGCUGA
AAGGCGAGGGCGCCGAAGGGUGCAGAGUUCCUCCCGCUCUGCAUGCCUGGGGGUAUGGGGA
AUACCCAUACCACUGUCACGGAGGUCUCUCCGUGGAGAGCCGUCGGUC
174

1
(((((((((((((((((((..........(((((((((....((.......)).))))))))).........))))))......(((((((((.......)))))))))))))...((((((((.....))))))))
.((.((((((((....))))))
174

Kiedy predykcja struktury TM_Lys jest pseudo zakolorowana zgodnie z prawdopodobieństwem parowania zasad, została uzyskana następująca reprezentacja graficzna, z parowaniem zasad, które są kolorowane według następującego klucza:

predykacja-parowania-zasad



Dodatkowo ta sama predykcja została pokolorowana na podstawie pozycji entropii.




Predykcja wolnej energii dla termodynamicznego zespołu wyniosła -96.4 kcal/mol. Dodatkowo środek ciężkości struktury drugorzędowej z wolną energią -92.20 kcal/mol został również przewidziany, ale ze względu na wzrost wolnej energii, a zatem mniej przewidywane stabilności został zignorowany. Dodatkowo pary zasad prawdopodobieństwa zostały uzyskane jako dot-plot, co pokazano poniżej:




Graficzne wyjście przewidywanych struktur drugorzędowych przy MFE i ciężkości formy jest również prezentowane w środku strony z wynikami, z możliwością pobrania struktur EPS, PDF lub plików GIF / PNG przez konwerter obrazu:




Graficzne reprezentacje drugorzędowej struktury TM_Lys na płaszczyźnie, prawdopodobny kolor par zasad oraz funkcji dzielenia uzyskano również z serwera, a zostały przedstawione poniżej:




Dodatkowo, serwer przedstawił informacje na temat wtórnego przewidywania struktury TM_Lys sekwencji poprzez wykres:




Struktura drugorzędowa MFE, zespół struktur termodynamicznych i ciężkości są reprezentowane przez czerwone, zielone oraz niebieskie ślady, odpowiednio z położenia wykresu entropii dla każdej pozycji poniżej górnego wykresu.




Dla człowieka TERT, pierwotnej sekwencji RNA została wpisana do RNAfold serwera w sposób podobny do drugiego przewidywania struktury TM_Lys i następujący wynik przewidywania dla minimalnej wolnej energii w notacji dot-bracket'a bez prawdopodobieństwa par zasad lub notacji entropii pozycji został otrzymany:

1
CAGGCAGCGCUGCGUCCUGCUGCGCACGUGGGAAGCCCUGGCCCCGGCCACCCCCGCGAUGCCGCG
CGCUCCCCGCUGCCGAGCCGUGCGCUCCCUGCUGCGCAGCCACUACCGCGAGGUGCUGCCGC
UGGCCACGUUCGUGCGGCGCCUGGGGCCCCAGGGCUGGCGGCUGGUGCAGCGCGGGGACCC
GGCGGCUUUCCGCGCGCUGGUGGCCCAGUGCCUGGUGUGCGUGCCCUGGGACGCACGGCCG
CCCCCCGCCGCCCCCUCCUUCCGCCAGGUGUCCUGCCUGAAGGAGCUGGUGGCCCGAGUGCU
GCAGAGGCUGUGCGAGCGCGGCGCGAAGAACGUGCUGGCCUUCGGCUUCGCGCUGCUGGAC
GGGGCCCGCGGGGGCCCCCCCGAGGCCUUCACCACCAGCGUGCGCAGCUACCUGCCCAACACG
GUGACCGACGCACUGCGGGGGAGCGGGGCGUGGGGGCUGCUGCUGCGCCGCGUGGGCGAC
GACGUGCUGGUUCACCUGCUGGCACGCUGCGCGCUCUUUGUGCUGGUGGCUCCCAGCUGCG
CCUACCAGGUGUGCGGGCCGCCGCUGUACCAGCUCGGCGCUGCCACUCAGGCCCGGCCCCCG
CCACACGCUAGUGGACCCCGAAGGCGUCUGGGAUGCGAACGGGCCUGGAACCAUAGCGUCA
GGGAGGCCGGGGUCCCCCUGGGCCUGCCAGCCCCGGGUGCGAGGAGGCGCGGGGGCAGUGCC
AGCCGAAGUCUGCCGUUGCCCAAGAGGCCCAGGCGUGGCGCUGCCCCUGAGCCGGAGCGGAC
GCCCGUUGGGCAGGGGUCCUGGGCCCACCCGGGCAGGACGCGUGGACCGAGUGACCGUGGU
UUCUGUGUGGUGUCACCUGCCAGACCCGCCGAAGAAGCCACCUCUUUGGAGGGUGCGCUCU
CUGGCACGCGCCACUCCCACCCAUCCGUGGGCCGCCAGCACCACGCGGGCCCCCCAUCCACAUC
GCGGCCACCACGUCCCUGGGACACGCCUUGUCCCCCGGUGUACGCCGAGACCAAGCACUUCC
UCUACUCCUCAGGCGACAAGGAGCAGCUGCGGCCCUCCUUCCUACUCAGCUCUCUGAGGCCC
AGCCUGACUGGCGCUCGGAGGCUCGUGGAGACCAUCUUUCUGGGUUCCAGGCCCUGGAUGC
CAGGGACUCCCCGCAGGUUGCCCCGCCUGCCCCAGCGCUACUGGCAAAUGCGGCCCCUGUUU
CUGGAGCUGCUUGGGAACCACGCGCAGUGCCCCUACGGGGUGCUCCUCAAGACGCACUGCCC
GCUGCGAGCUGCGGUCACCCCAGCAGCCGGUGUCUGUGCCCGGGAGAAGCCCCAGGGCUCU
GUGGCGGCCCCCGAGGAGGAGGACACAGACCCCCGUCGCCUGGUGCAGCUGCUCCGCCAGCA
CAGCAGCCCCUGGCAGGUGUACGGCUUCGUGCGGGCCUGCCUGCGCCGGCUGGUGCCCCCA
GGCCUCUGGGGCUCCAGGCACAACGAACGCCGCUUCCUCAGGAACACCAAGAAGUUCAUCUCC
CUGGGGAAGCAUGCCAAGCUCUCGCUGCAGGAGCUGACGUGGAAGAUGAGCGUGCGGGACU
GCGCUUGGCUGCGCAGGAGCCCAGGGGUUGGCUGUGUUCCGGCCGCAGAGCACCGUCUGCG
UGAGGAGAUCCUGGCCAAGUUCCUGCACUGGCUGAUGAGUGUGUACGUCGUCGAGCUGCU
CAGGUCUUUCUUUUAUGUCACGGAGACCACGUUUCAAAAGAACAGGCUCUUUUUCUACCGG
AAGAGUGUCUGGAGCAAGUUGCAAAGCAUUGGAAUCAGACAGCACUUGAAGAGGGUGCAGC
UGCGGGAGCUGUCGGAAGCAGAGGUCAGGCAGCAUCGGGAAGCCAGGCCCGCCCUGCUGAC
GUCCAGACUCCGCUUCAUCCCCAAGCCUGACGGGCUGCGGCCGAUUGUGAACAUGGACUACG
UCGUGGGAGCCAGAACGUUCCGCAGAGAAAAGAGGGCCGAGCGUCUCACCUCGAGGGUGAA
GGCACUGUUCAGCGUGCUCAACUACGAGCGGGCGCGGCGCCCCGGCCUCCUGGGCGCCUCUG
UGCUGGGCCUGGACGAUAUCCACAGGGCCUGGCGCACCUUCGUGCUGCGUGUGCGGGCCCA
GGACCCGCCGCCUGAGCUGUACUUUGUCAAGGUGGAUGUGACGGGCGCGUACGACACCAUC
CCCCAGGACAGGCUCACGGAGGUCAUCGCCAGCAUCAUCAAACCCCAGAACACGUACUGCGU
GCGUCGGUAUGCCGUGGUCCAGAAGGCCGCCCAUGGGCACGUCCGCAAGGCCUUCAAGAGCC
ACGUCUCUACCUUGACAGACCUCCAGCCGUACAUGCGACAGUUCGUGGCUCACCUGCAGGAG
ACCAGCCCGCUGAGGGAUGCCGUCGUCAUCGAGCAGAGCUCCUCCCUGAAUGAGGCCAGCAG
UGGCCUCUUCGACGUCUUCCUACGCUUCAUGUGCCACCACGCCGUGCGCAUCAGGGGCAAG
UCCUACGUCCAGUGCCAGGGGAUCCCGCAGGGCUCCAUCCUCUCCACGCUGCUCUGCAGCCU
GUGCUACGGCGACAUGGAGAACAAGCUGUUUGCGGGGAUUCGGCGGGACGGGCUGCUCCU
GCGUUUGGUGGAUGAUUUCUUGUUGGUGACACCUCACCUCACCCACGCGAAAACCUUCCUC
AGGACCCUGGUCCGAGGUGUCCCUGAGUAUGGCUGCGUGGUGAACUUGCGGAAGACAGUG
GUGAACUUCCCUGUAGAAGACGAGGCCCUGGGUGGCACGGCUUUUGUUCAGAUGCCGGCCC
ACGGCCUAUUCCCCUGGUGCGGCCUGCUGCUGGAUACCCGGACCCUGGAGGUGCAGAGCGA
CUACUCCAGCUAUGCCCGGACCUCCAUCAGAGCCAGUCUCACCUUCAACCGCGGCUUCAAGG
CUGGGAGGAACAUGCGUCGCAAACUCUUUGGGGUCUUGCGGCUGAAGUGUCACAGCCUGU
UUCUGGAUUUGCAGGUGAACAGCCUCCAGACGGUGUGCACCAACAUCUACAAGAUCCUCCU
GCUGCAGGCGUACAGGUUUCACGCAUGUGUGCUGCAGCUCCCAUUUCAUCAGCAAGUUUGG
AAGAACCCCACAUUUUUCCUGCGCGUCAUCUCUGACACGGCCUCCCUCUGCUACUCCAUCCU
GAAAGCCAAGAACGCAGGGAUGUCGCUGGGGGCCAAGGGCGCCGCCGGCCCUCUGCCCUCCG
AGGCCGUGCAGUGGCUGUGCCACCAAGCAUUCCUGCUCAAGCUGACUCGACACCGUGUCACC
UACGUGCCACUCCUGGGGUCACUCAGGACAGCCCAGACGCAGCUGAGUCGGAAGCUCCCGGG
GACGACGCUGACUGCCCUGGAGGCCGCAGCCAACCCGGCACUGCCCUCAGACUUCAAGACCA
UCCUGGACUGAUGGCCACCCGCCCACAGCCAGGCCGAGAGCAGACACCAGCAGCCCUGUCACG
CCGGGCUCUACGUCCCAGGGAGGGAGGGGCGGCCCACACCCAGGCCCGCACCGCUGGGAGUC
UGAGGCCUGAGUGAGUGUUUGGCCGAGGCCUGCAUGUCCGGCUGAAGGCUGAGUGUCCGG
CUGAGGCCUGAGCGAGUGUCCAGCCAAGGGCUGAGUGUCCAGCACACCUGCCGUCUUCACU
UCCCCACAGGCUGGCGCUCGGCUCCACCCCAGGGCCAGCUUUUCCUCACCAGGAGCCCGGCU
UCCACUCCCCACAUAGGAAUAGUCCAUCCCCAGAUUCGCCAUUGUUCACCCCUCGCCCUGCCC
UCCUUUGCCUUCCACCCCCACCAUCCAGGUGGAGACCCUGAGAAGGACCCUGGGAGCUCUGG
GAAUUUGGAGUGACCAAAGGUGUGCCCUGUACACAGGCGAGGACCCUGCACCUGGAUGGGG
GUCCCUGUGGGUCAAAUUGGGGGGAGGUGCUGUGGGAGUAAAAUACUGAAUAUAUGAGU
UUUUCAGUUUUGAAAAAAA
4018

1
..(((((((((((((...((.(((((((.(((.(((..((((....))))....((((....)))).))).)))(((....)))))))))).....)).)))))))....(((....)))))))))(((((((...
...((((((.((((((((((((.((((((((((((((((((((..((....))((((((...(((((((((((((((.((((((..((.((((((((((((((.((((((((.((((((...((
((((((((..(((((((...((((......)))).)))))))(((((((((.((((.((((((((((((((((((((.....))))).((((...)))).))))))(((((..((((((..(((((....)))
)).)))))).....))))).)))))))))..))))......(((...)))..))))).)))))))).)))))).)))))).)))).)))))).)).)))).....(((((..((......))..)))
))..)))))).))..))))))(((((.....)))))))).)))).)))))))))))))))))))))))))).(((...)))....(((((((((((((.(((.(((((..(((...)))..))))
).)))(((((....((........))...))))).))).))))(((....))).)))))))))))))).))).))..((((((.(((((((((((((((((...((((((....)).....))))..
.))).)))))))))))))).)))((((.((..(((((.(((((.((....))..)))))..)))))....((((((..(((((((((((((((((((..((((.(((........)))))))...)
))))))))(((....)))))).)))))...)))))))))).))))......)))((((((((((.((.((....))))(((((........((.((...)).))((((((((((....((((((((.
((((....))))(((..((....))..)))........)).))))))((((.(((((((((...(((((.(((((((..(((....(((((((((((((((.((.(((((..((.((..........(((((((((
(((.((((((...)))))).......(((((((((.((((.((((((((.....)))).......((((.((((((((((.((((((.(((........((((((((((....)))..((.....))..)))))))
((((........))))...))).)))))).(((((.((((((.((....(((((((((((.(((.((.(((((.....((((.((........)))).))(((.((((((((((((..........))))))....(
(((((((((((....)))))..)))))))))))))))).)).))))))))))).)))))))))).))))))....)))))(((((((((((....................)))))))))))......(((((((
(((((((..((((((((((((((((((((((((((.((((((......))))))...)))((((((((((((..((((...((((((......))))))...))))....))))))).))))))))).(((((
((((.((....))))))).)))))))))......)))))))))))...(((((...))))).......(((((.(((((((....))))))).))))).)))...))))).(((..((........))((((((..
...)))))).)))))))))))).)))))))))).)))).))))))...(((((...(((((.((((.(((..((((.....(((((.((((((((((((..(((((((....)))...((....))
.......))))((((((((.((..((((((((..((...(((((((((((.((((((((.....)))).)))).)).....((.(((((......))))).)).))))((((.((...)).)))).)
))))...)).((((((((((.........(((((((.(((((...........))))))))))))(((((..(((.(((((((((...((((((((((((((...((((.(((((((((...((.((
(....)))..)).....((.(((..................)))))......))))).)))).))))((....))((((((..(((((((.....((((....))))...)))))))..)).))))...))))))))))
))))....))))......((((((.((..(((((.((...(((((((((((.(((.....))).)).....(((...((((...))))......(((.(((((((....)))))))))))))))).))
))..))....)).)))))...)).)).))))))))))))..))))).))))))).)))...(((((((((((((((......((((((.(((((...))))).(((((....)).)))))))))...
))))..)))).))))))).))))))))..)))))))))))))))).)))))).........(((((....)))))(((((.(((((....((...(((((((((((......))).)).))))))..
.)).))))))))))....)))))..((((.((.......))))))....)))).)))...))))(((.((((.(((....))).)))))))...))))).)))))..)).)))))))))..))))).
)))))))..((((((.(((...)))....)))))).....))))..)))))...)).)))))))...((.........)).....)))))))).)))...((((((((((((((....)))).))))(
((((..(((((.((((.((.....(((..(((.((((.((((((((((((((((((......))))).....((.......(((((((.((((((.((.....)).))))))))))))).......))........)
)))))).................((((((((((....))))..((((((............((((((....((.......)).)))))).....((((((..(((((.......)))))..)))).)))))
))))))))).))))))..))))..))).)))....)).))))....))))).(((.(((....))).)))(((((((....))))))))))))..))))))))))))).)))))...((((((.((
........)))))))).)))))))))....(((((.((((.(((...((...)).....(((((.(((..(((.....)))..))))))))..))).))))....(((.....)))....)))))))))
...))))))))))))).)))))))))))).)))))))))))))..(((((.((...((((((.(((.(((.((..((((.(((......)))))))..)).)))((...))..))).))))))(((
((((((.((((((..(((..(((((....(((....)))......))))).)))...))))))))))).)))).))))))))))))))..(((((....)))))((((((..((.(((((((....(((....))
)..((((((..(((((.(((.((((.((...(((....(((((...(((((((...(((((.....)))))......)).))))).....)))))....))).....)).)))).)))..((((((...
)))))).)))))(((((((.((......)))))))))))).)))......))))))).)).)))).))......((.((((((...........)))))).))........
4018

Kiedy struktura TERT została pokolorowana zgodnie z prawdopodobieństwem par zasad uzyskano następującą reprezentację graficzną:









Ponadto sama predykcja dla TERT została pokolorowana na podstawie pozycji entropii, uzyskano następującą reprezentację graficzną na podstawie par zasad jak w opisie








Predykcja wolnej energii dla termodynamicznego zespołu wyniosła -2034.50 kcal/mol. Dodatkowo środek ciężkości struktury drugorzędowej z wolną energią -1018.97 kcal/mol został również przewidziany, ale ze względu na wzrost wolnej energii, a zatem mniej przewidywane stabilności został zignorowany. Dodatkowo pary zasad prawdopodobieństwa zostały uzyskane jako dot-plot, co pokazano poniżej:




Graficzne reprezentacje drugorzędowej struktury TERT w MFE, kolor prawdopodobieństwa par zasad i funkcji dzielenia został uzyskany również z serwera. Reprezentacje zostały przedstawione poniżej:
drzewa-tert-w-mfe



Ponadto serwer przedstawił informacje na temat wtórnego przewidywania struktury TERT sekwencji poprzez wykres, kiedy wtórne struktury MFE, zespół termodynamicznych i struktur ciężkości były reprezentowane przez ślady w kolorach czerwonym, zielonym i niebieskim, z położenia wykresu entropii dla każdej pozycji prezentowanej poniżej wykresu.




Dlatego RNAfold server w Vienna RNA server suite dostarczyły informacji na temat predykcji drugorzędowej struktury TERT mRNA używając MFE, entropii pozycyjnej, zespołu algorytmow termodynamicznych, ustanawiając fakt, że proste predykcje drugorzędowej struktury RNA są możliwe na stronie.

Vienna RNA server jest cennym źródłem dla przewidywania drugorzędowych struktur RNA w oparciu o minimum wolnej energii, algorytmy pozycyjne entropii z krzywą uczenia się i prosty interfejs WWW. Trzeciorzędowa struktura RNA jest odpowiedzialna za jej swoistość dla docelowego DNA lub RNA i jego funkcji.

Autor: Krzysztof Wołk

Komentarze

Widok Uszereguj
Tylko zarejestrowani mogą dodawać komentarze. Zarejestruj się/Zaloguj

Podręcznik biotechnologii

Kto jest online

206 gości oraz 0 użytkowników online.

Jesteś niezarejestrowanym lub niezalogowanym użytkownikiem.


 
 
 
Partnerzy:

laboratoria.net Nauka w Polsce Academio Fundacja NanoNet BioCen - BioCentrum Edukacji Naukowej Notatek.pl cebioforum.com materialyinzynierskie.pl Wspieram.to - POLSKI KICKSTARTER - Polska platforma finansowania społecznoœciowego.Tu zrealizujš się Twoje pomysły. VitaInSilica Portal popularnonaukowy matura.biomist.pl

Portal: Redakcja . Współpraca . Kontakt . Polecamy



Wszystkie prawa zastrzeżone 2006-2016 e-biotechnologia.pl
stat4u